Transcript: Human NM_001265612.2

Homo sapiens CCR4-NOT transcription complex subunit 1 (CNOT1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-19
Taxon:
Homo sapiens (human)
Gene:
CNOT1 (23019)
Length:
8396
CDS:
274..7389

Additional Resources:

NCBI RefSeq record:
NM_001265612.2
NBCI Gene record:
CNOT1 (23019)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001265612.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137172 GCGATCCAACTATGAAGCAAT pLKO.1 5697 CDS 100% 4.950 6.930 N CNOT1 n/a
2 TRCN0000285484 CAGCTATTTCCAGCGAATATA pLKO_005 2805 CDS 100% 15.000 12.000 N CNOT1 n/a
3 TRCN0000240024 ACCTTCATTGAGCTGATTAAA pLKO_005 7231 CDS 100% 15.000 10.500 N Gm6158 n/a
4 TRCN0000276067 CATTCAACATTCCCTTATAAA pLKO_005 1497 CDS 100% 15.000 10.500 N CNOT1 n/a
5 TRCN0000235212 TCCTTTGTGATTACCATTATG pLKO_005 6584 CDS 100% 13.200 9.240 N EG665105 n/a
6 TRCN0000235305 TCCTTTGTGATTACCATTATG pLKO_005 6584 CDS 100% 13.200 9.240 N EG665100 n/a
7 TRCN0000136340 GCCAAATTGTCTCGAATACTT pLKO.1 1936 CDS 100% 5.625 3.938 N CNOT1 n/a
8 TRCN0000276068 GCCAAATTGTCTCGAATACTT pLKO_005 1936 CDS 100% 5.625 3.938 N CNOT1 n/a
9 TRCN0000136514 CCACCTAATTGTATCCAGTTA pLKO.1 6622 CDS 100% 4.950 3.465 N CNOT1 n/a
10 TRCN0000168141 CGAAACTGCATCTCTGTTGTA pLKO.1 7391 3UTR 100% 4.950 3.465 N CNOT1 n/a
11 TRCN0000136673 GCGTTTAAGTTCTGGAACCAT pLKO.1 7258 CDS 100% 3.000 2.100 N CNOT1 n/a
12 TRCN0000276071 TGCCTATTTGGTGGTATAATT pLKO_005 3001 CDS 100% 15.000 9.000 N CNOT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001265612.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.