Transcript: Mouse NM_001267707.1

Mus musculus solute carrier organic anion transporter family, member 1a5 (Slco1a5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Mus musculus (mouse)
Gene:
Slco1a5 (108096)
Length:
2624
CDS:
177..2189

Additional Resources:

NCBI RefSeq record:
NM_001267707.1
NBCI Gene record:
Slco1a5 (108096)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001267707.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079242 CACTTTATGATAAGCTGTGAT pLKO.1 1389 CDS 100% 4.950 6.930 N Slco1a5 n/a
2 TRCN0000348888 TGGCATCCCTGCACCCATTTA pLKO_005 1853 CDS 100% 13.200 9.240 N Slco1a5 n/a
3 TRCN0000079239 CCCTGCATTCTTCATTCTGAT pLKO.1 2018 CDS 100% 4.950 3.465 N Slco1a5 n/a
4 TRCN0000352129 CCCTGCATTCTTCATTCTGAT pLKO_005 2018 CDS 100% 4.950 3.465 N Slco1a5 n/a
5 TRCN0000079238 GCTCACTCATTCTAGTCACAT pLKO.1 2354 3UTR 100% 4.950 3.465 N Slco1a5 n/a
6 TRCN0000352049 GCTCACTCATTCTAGTCACAT pLKO_005 2354 3UTR 100% 4.950 3.465 N Slco1a5 n/a
7 TRCN0000079241 GCTCCAGATAAACGCATTTAT pLKO.1 1154 CDS 100% 1.500 1.050 N Slco1a5 n/a
8 TRCN0000352128 GCTCCAGATAAACGCATTTAT pLKO_005 1154 CDS 100% 1.500 1.050 N Slco1a5 n/a
9 TRCN0000079240 CCAGATAAACGCATTTATCAA pLKO.1 1157 CDS 100% 0.563 0.394 N Slco1a5 n/a
10 TRCN0000043085 GCTTTGAGATTGGAAATCTTT pLKO.1 367 CDS 100% 5.625 3.375 N SLCO1A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001267707.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.