Transcript: Mouse NM_001270456.1

Mus musculus predicted gene 3259 (Gm3259), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Gm3259 (100041296)
Length:
2299
CDS:
235..1662

Additional Resources:

NCBI RefSeq record:
NM_001270456.1
NBCI Gene record:
Gm3259 (100041296)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001270456.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367172 GAGAATAGGATCCCTATATTT pLKO_005 732 CDS 100% 15.000 7.500 Y C87414 n/a
2 TRCN0000269611 CAAGATGAATGTGGAACAATA pLKO_005 1443 CDS 100% 13.200 6.600 Y E330014E10Rik n/a
3 TRCN0000367174 CATGGGTCTTTGACTATTAAC pLKO_005 1955 3UTR 100% 13.200 6.600 Y C87414 n/a
4 TRCN0000216046 CTTATATGCTTTGGATCTTAT pLKO.1 1221 CDS 100% 13.200 6.600 Y AA792892 n/a
5 TRCN0000246844 CTTATATGCTTTGGATCTTAT pLKO_005 1221 CDS 100% 13.200 6.600 Y AA792892 n/a
6 TRCN0000367173 GTGAAGGTCCTTCCGAGATAT pLKO_005 619 CDS 100% 13.200 6.600 Y C87414 n/a
7 TRCN0000367107 CTTCATGAAACACGTCCATTT pLKO_005 1044 CDS 100% 10.800 5.400 Y C87414 n/a
8 TRCN0000367175 GACCCACCAGACCAAGTTATC pLKO_005 778 CDS 100% 10.800 5.400 Y C87414 n/a
9 TRCN0000376335 TGAAGGACTCCCAGATCAATG pLKO_005 1310 CDS 100% 10.800 5.400 Y C87414 n/a
10 TRCN0000376272 TTATATGCTTTGGATCTTATG pLKO_005 1222 CDS 100% 10.800 5.400 Y C87414 n/a
11 TRCN0000376273 TCTATGACCAGGGCCCAATAC pLKO_005 1622 CDS 100% 10.800 5.400 Y C87414 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001270456.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.