Transcript: Mouse NM_001270791.1

Mus musculus IBA57 homolog, iron-sulfur cluster assembly (Iba57), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Iba57 (216792)
Length:
950
CDS:
55..759

Additional Resources:

NCBI RefSeq record:
NM_001270791.1
NBCI Gene record:
Iba57 (216792)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001270791.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182041 CAGCCATAACGCTGCATCTTT pLKO.1 775 3UTR 100% 5.625 7.875 N Iba57 n/a
2 TRCN0000430944 GCACGCTCTATGACGTCATTC pLKO_005 368 CDS 100% 10.800 8.640 N Iba57 n/a
3 TRCN0000085371 CTGTTGGGACTATCGACCAAT pLKO.1 262 CDS 100% 4.950 3.960 N Iba57 n/a
4 TRCN0000198598 CCCACACTACAGAAAGCAAGA pLKO.1 564 CDS 100% 4.050 2.835 N Iba57 n/a
5 TRCN0000198582 GACCAATCACAGACTTGCCTA pLKO.1 716 CDS 100% 2.640 1.848 N Iba57 n/a
6 TRCN0000181645 GCAAAGCTCAGGAAAGTCTTC pLKO.1 635 CDS 100% 4.050 2.430 N Iba57 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001270791.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.