Transcript: Human NM_001270892.2

Homo sapiens trafficking protein particle complex 6A (TRAPPC6A), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
TRAPPC6A (79090)
Length:
732
CDS:
20..403

Additional Resources:

NCBI RefSeq record:
NM_001270892.2
NBCI Gene record:
TRAPPC6A (79090)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001270892.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437628 GTCTGTAAGTTCCAGGTGGTG pLKO_005 438 3UTR 100% 2.160 3.024 N TRAPPC6A n/a
2 TRCN0000437499 TTCTTCACACGGAGATGGTGG pLKO_005 45 CDS 100% 2.160 3.024 N TRAPPC6A n/a
3 TRCN0000179048 CTCAGGAAGTGGGTATCAAAT pLKO.1 593 3UTR 100% 13.200 9.240 N TRAPPC6A n/a
4 TRCN0000180510 GCTCAGGAAGTGGGTATCAAA pLKO.1 592 3UTR 100% 5.625 3.938 N TRAPPC6A n/a
5 TRCN0000180596 GTTCTTGTGCAAAGACCTGTG pLKO.1 194 CDS 100% 2.250 1.575 N TRAPPC6A n/a
6 TRCN0000444496 TATACCCTGGGCATTGAGAGC pLKO_005 387 CDS 100% 2.160 1.512 N TRAPPC6A n/a
7 TRCN0000180414 GCTGGATGTCCTCAAGTTCTT pLKO.1 179 CDS 100% 4.950 2.970 N TRAPPC6A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001270892.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.