Transcript: Human NM_001270949.1

Homo sapiens TNF receptor superfamily member 11a (TNFRSF11A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-28
Taxon:
Homo sapiens (human)
Gene:
TNFRSF11A (8792)
Length:
3809
CDS:
67..858

Additional Resources:

NCBI RefSeq record:
NM_001270949.1
NBCI Gene record:
TNFRSF11A (8792)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001270949.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367374 TGTTTACTTGCCCGGTTTAAT pLKO_005 690 CDS 100% 15.000 21.000 N TNFRSF11A n/a
2 TRCN0000356074 TGTACCAGTGAGAAGCATTAT pLKO_005 166 CDS 100% 13.200 18.480 N TNFRSF11A n/a
3 TRCN0000377209 TGGGACGGTGCTGTAACAAAT pLKO_005 194 CDS 100% 13.200 10.560 N TNFRSF11A n/a
4 TRCN0000367440 GAAAGCACTCACAGCTAATTT pLKO_005 783 CDS 100% 15.000 10.500 N TNFRSF11A n/a
5 TRCN0000065702 GATAAATGCTTGCTGCATAAA pLKO.1 316 CDS 100% 13.200 9.240 N Tnfrsf11a n/a
6 TRCN0000003352 GCCCGGATGAATACTTGGATA pLKO.1 281 CDS 100% 4.950 3.465 N TNFRSF11A n/a
7 TRCN0000003350 CCATGTTTACTTGCCCGGTTT pLKO.1 687 CDS 100% 4.050 2.835 N TNFRSF11A n/a
8 TRCN0000003351 CCAGTGTGTGTTCATTGTAAA pLKO.1 1940 3UTR 100% 13.200 7.920 N TNFRSF11A n/a
9 TRCN0000164801 CCTCCCAAAGTACTGGGATTA pLKO.1 1840 3UTR 100% 1.080 0.540 Y MAPKAPK5-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001270949.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.