Transcript: Mouse NM_001270996.1

Mus musculus a disintegrin and metallopeptidase domain 9 (meltrin gamma) (Adam9), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Adam9 (11502)
Length:
4057
CDS:
142..2733

Additional Resources:

NCBI RefSeq record:
NM_001270996.1
NBCI Gene record:
Adam9 (11502)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001270996.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031815 CCTGAATTATGACTGTGACAT pLKO.1 2058 CDS 100% 4.950 3.960 N Adam9 n/a
2 TRCN0000031814 CCTTGGAGATTAACTAGAGAA pLKO.1 283 CDS 100% 4.950 3.465 N Adam9 n/a
3 TRCN0000323783 CCTTGGAGATTAACTAGAGAA pLKO_005 283 CDS 100% 4.950 3.465 N Adam9 n/a
4 TRCN0000031817 GCTTAGCAAACTACCTGGATA pLKO.1 863 CDS 100% 4.950 3.465 N Adam9 n/a
5 TRCN0000323722 GCTTAGCAAACTACCTGGATA pLKO_005 863 CDS 100% 4.950 3.465 N Adam9 n/a
6 TRCN0000031818 GCTCACACTTTGAGCACATAT pLKO.1 605 CDS 100% 1.320 0.924 N Adam9 n/a
7 TRCN0000323719 GCTCACACTTTGAGCACATAT pLKO_005 605 CDS 100% 1.320 0.924 N Adam9 n/a
8 TRCN0000031816 GCTGTGAAGGAAGCACTTGTA pLKO.1 1463 CDS 100% 4.950 2.970 N Adam9 n/a
9 TRCN0000323718 GCTGTGAAGGAAGCACTTGTA pLKO_005 1463 CDS 100% 4.950 2.970 N Adam9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001270996.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.