Transcript: Mouse NM_001271005.1

Mus musculus histocompatibility 2, T region locus, pseudogene (H2-T-ps), mRNA.

Source:
NCBI, updated 2016-05-31
Taxon:
Mus musculus (mouse)
Gene:
H2-T-ps (667803)
Length:
1289
CDS:
20..1024

Additional Resources:

NCBI RefSeq record:
NM_001271005.1
NBCI Gene record:
H2-T-ps (667803)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001271005.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067006 GTCTCCAACATGGTAATCATT pLKO.1 920 CDS 100% 5.625 2.813 Y H2-Q2 n/a
2 TRCN0000067544 CGGCTACTACAATCAGAGTAA pLKO.1 325 CDS 100% 4.950 2.475 Y H2-T23 n/a
3 TRCN0000067545 CCAGGATTACATCTCCCTGAA pLKO.1 439 CDS 100% 4.050 2.025 Y H2-T23 n/a
4 TRCN0000066903 GAGCAGAATTACACATGCCAT pLKO.1 839 CDS 100% 2.640 1.320 Y H2-Q6 n/a
5 TRCN0000192133 GAGCAGAATTACACATGCCAT pLKO.1 839 CDS 100% 2.640 1.320 Y H2-D1 n/a
6 TRCN0000067546 GCTATGCTCATGTTCTAGGCA pLKO.1 1031 3UTR 100% 0.750 0.375 Y H2-T23 n/a
7 TRCN0000066907 GAATTACACATGCCATGTGAA pLKO.1 844 CDS 100% 4.950 2.475 Y H2-Q6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271005.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.