Transcript: Mouse NM_001271510.1

Mus musculus lymphocyte specific 1 (Lsp1), transcript variant 5, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Lsp1 (16985)
Length:
1725
CDS:
88..1080

Additional Resources:

NCBI RefSeq record:
NM_001271510.1
NBCI Gene record:
Lsp1 (16985)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001271510.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090968 GCCCTGACCAAGAAATTGCTT pLKO.1 1121 3UTR 100% 3.000 4.200 N Lsp1 n/a
2 TRCN0000090971 CATGGGAAGTACGAGAAAGTA pLKO.1 1033 CDS 100% 5.625 4.500 N Lsp1 n/a
3 TRCN0000349435 CATGGGAAGTACGAGAAAGTA pLKO_005 1033 CDS 100% 5.625 4.500 N Lsp1 n/a
4 TRCN0000349883 ATGAACGCCTGCAGCAGTATA pLKO_005 743 CDS 100% 13.200 9.240 N Lsp1 n/a
5 TRCN0000313346 AGTCCCTGAACCGCTCCATTA pLKO_005 668 CDS 100% 10.800 7.560 N Lsp1 n/a
6 TRCN0000090972 GAGAGTTCTCACCAAGCCAAA pLKO.1 457 CDS 100% 4.050 2.835 N Lsp1 n/a
7 TRCN0000312215 GAGAGTTCTCACCAAGCCAAA pLKO_005 457 CDS 100% 4.050 2.835 N Lsp1 n/a
8 TRCN0000090970 GCAGAGTCAGTCTGCTTCTAA pLKO.1 876 CDS 100% 0.563 0.394 N Lsp1 n/a
9 TRCN0000090969 GCTGGAGACATGAGCAAGAAA pLKO.1 922 CDS 100% 5.625 2.813 Y Lsp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271510.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.