Transcript: Mouse NM_001271538.1

Mus musculus myosin, heavy polypeptide 14 (Myh14), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Myh14 (71960)
Length:
6515
CDS:
7..6108

Additional Resources:

NCBI RefSeq record:
NM_001271538.1
NBCI Gene record:
Myh14 (71960)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001271538.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110574 CATTACCGAAAGCTAGTGCTA pLKO.1 5440 CDS 100% 2.640 3.696 N Myh14 n/a
2 TRCN0000110570 CCTCCTGGTTTGCACTTTGAA pLKO.1 6155 3UTR 100% 5.625 3.938 N Myh14 n/a
3 TRCN0000110573 CCGGGCTCATTTATACCTACT pLKO.1 386 CDS 100% 4.050 2.835 N Myh14 n/a
4 TRCN0000110572 GTTTGGCAACATTGTCCTGAA pLKO.1 1116 CDS 100% 4.050 2.835 N Myh14 n/a
5 TRCN0000110571 CACCGACATCATAGTGTCTTT pLKO.1 2526 CDS 100% 4.950 2.970 N Myh14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271538.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.