Transcript: Human NM_001271775.2

Homo sapiens ral guanine nucleotide dissociation stimulator (RALGDS), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
RALGDS (5900)
Length:
3690
CDS:
84..2825

Additional Resources:

NCBI RefSeq record:
NM_001271775.2
NBCI Gene record:
RALGDS (5900)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271775.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000281739 GAGTCCCATCGATGTTGAATC pLKO_005 3438 3UTR 100% 10.800 15.120 N RALGDS n/a
2 TRCN0000281797 GGGACAGTTTCCGGATCTTTC pLKO_005 1597 CDS 100% 10.800 15.120 N RALGDS n/a
3 TRCN0000048028 GCCATGAAGGACTATCTGTAT pLKO.1 1818 CDS 100% 4.950 6.930 N RALGDS n/a
4 TRCN0000271468 AGATAAGGCTCCGGCTGTAAT pLKO_005 2546 CDS 100% 13.200 10.560 N RALGDS n/a
5 TRCN0000271514 TCGCGCCAGATGAGCAATTTG pLKO_005 1930 CDS 100% 13.200 9.240 N RALGDS n/a
6 TRCN0000281798 GGACCAGTACTCGGAGGATTT pLKO_005 695 CDS 100% 10.800 7.560 N RALGDS n/a
7 TRCN0000048030 CAAGAACTTCTCGTCACTGTA pLKO.1 1508 CDS 100% 4.950 3.465 N RALGDS n/a
8 TRCN0000048029 CCCTGAACCTTTATGAGACTT pLKO.1 391 CDS 100% 4.950 3.465 N RALGDS n/a
9 TRCN0000048031 CCTGTGTACCTATAGAGCCTT pLKO.1 509 CDS 100% 2.640 1.848 N RALGDS n/a
10 TRCN0000055073 GCCTGCAACAACTACAGCATT pLKO.1 1911 CDS 100% 4.950 3.465 N Ralgds n/a
11 TRCN0000331713 GCCTGCAACAACTACAGCATT pLKO_005 1911 CDS 100% 4.950 3.465 N Ralgds n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271775.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.