Transcript: Mouse NM_001271800.1

Mus musculus protocadherin 9 (Pcdh9), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Pcdh9 (211712)
Length:
5454
CDS:
157..3642

Additional Resources:

NCBI RefSeq record:
NM_001271800.1
NBCI Gene record:
Pcdh9 (211712)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001271800.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241635 TGACGTAATTAGTACCATTAA pLKO_005 4560 3UTR 100% 13.200 18.480 N Pcdh9 n/a
2 TRCN0000241632 TCCCTATTCAGGAGTCATAAA pLKO_005 2019 CDS 100% 13.200 10.560 N Pcdh9 n/a
3 TRCN0000055941 CGTAAGCAGTATGGCTCCAAT pLKO.1 3511 CDS 100% 4.950 3.960 N PCDH9 n/a
4 TRCN0000241633 ACCGTCTTGTGGTCAACATAA pLKO_005 2402 CDS 100% 13.200 9.240 N Pcdh9 n/a
5 TRCN0000241636 CATAGACCTCAGGTACATTAT pLKO_005 1227 CDS 100% 13.200 9.240 N Pcdh9 n/a
6 TRCN0000241634 CATCAATGTCACCGATGTAAA pLKO_005 1191 CDS 100% 13.200 9.240 N Pcdh9 n/a
7 TRCN0000312747 CATCAATGTCACCGATGTAAA pLKO_005 1191 CDS 100% 13.200 9.240 N PCDH9 n/a
8 TRCN0000055942 CCAGTGTTTAAAGAGGGTCAA pLKO.1 904 CDS 100% 4.050 2.835 N PCDH9 n/a
9 TRCN0000055940 CCCAAGTTTACTCATAATCAT pLKO.1 1864 CDS 100% 5.625 3.938 N PCDH9 n/a
10 TRCN0000363581 CCCAAGTTTACTCATAATCAT pLKO_005 1864 CDS 100% 5.625 3.938 N PCDH9 n/a
11 TRCN0000055939 CCAACAGAATAGACAGAGAAA pLKO.1 422 CDS 100% 4.950 3.465 N PCDH9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271800.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06693 pDONR223 100% 86.8% 92.6% None (many diffs) n/a
2 ccsbBroad304_06693 pLX_304 0% 86.8% 92.6% V5 (many diffs) n/a
3 TRCN0000477261 TTCGGCAAACACGATGGTGTCGAG pLX_317 10.2% 86.8% 92.6% V5 (many diffs) n/a
Download CSV