Transcript: Mouse NM_001271898.1

Mus musculus acyl-Coenzyme A oxidase 1, palmitoyl (Acox1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Acox1 (11430)
Length:
3992
CDS:
342..2327

Additional Resources:

NCBI RefSeq record:
NM_001271898.1
NBCI Gene record:
Acox1 (11430)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001271898.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076763 CCACCTTCAATCCAGAGTTAA pLKO.1 376 CDS 100% 13.200 9.240 N Acox1 n/a
2 TRCN0000076764 GCAGCCAGATTGGTAGAAATT pLKO.1 1812 CDS 100% 13.200 9.240 N Acox1 n/a
3 TRCN0000076766 CCTTCCACTTTCTCGGAAGAT pLKO.1 1360 CDS 100% 0.495 0.347 N Acox1 n/a
4 TRCN0000076767 CCTGAAGAAATCATGTGGTTT pLKO.1 585 CDS 100% 4.950 2.970 N Acox1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271898.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05760 pDONR223 100% 80.6% 84.2% None (many diffs) n/a
Download CSV