Transcript: Mouse NM_001276489.1

Mus musculus isthmin 1, angiogenesis inhibitor (Ism1), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Ism1 (319909)
Length:
2965
CDS:
493..1878

Additional Resources:

NCBI RefSeq record:
NM_001276489.1
NBCI Gene record:
Ism1 (319909)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001276489.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086791 GCGGGAAGTGAGGAGTTTAAT pLKO.1 1318 CDS 100% 15.000 21.000 N Ism1 n/a
2 TRCN0000254072 ACCAAACTTTCCAGATCTTTC pLKO_005 804 CDS 100% 10.800 7.560 N ISM1 n/a
3 TRCN0000086792 CCCAGGAATTGAAGATACTTT pLKO.1 1266 CDS 100% 5.625 3.938 N Ism1 n/a
4 TRCN0000086789 GCCCAGGAATTGAAGATACTT pLKO.1 1265 CDS 100% 5.625 3.938 N Ism1 n/a
5 TRCN0000086790 CCAAACATTCAGGTCACCATA pLKO.1 850 CDS 100% 4.950 3.465 N Ism1 n/a
6 TRCN0000086788 GCAGAGTCAAATCTAAGACAT pLKO.1 2471 3UTR 100% 4.950 3.465 N Ism1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001276489.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.