Transcript: Mouse NM_001276680.1

Mus musculus synaptotagmin VI (Syt6), transcript variant 5, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Syt6 (54524)
Length:
1857
CDS:
415..1443

Additional Resources:

NCBI RefSeq record:
NM_001276680.1
NBCI Gene record:
Syt6 (54524)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001276680.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243856 TCCTCGCCGTGGTAGTTATTG pLKO_005 338 5UTR 100% 13.200 18.480 N Syt6 n/a
2 TRCN0000243860 ATGAAAGCGAGACGCTGATTG pLKO_005 884 CDS 100% 10.800 7.560 N Syt6 n/a
3 TRCN0000243858 ATGTCTCCAGCGTGGACTATG pLKO_005 710 CDS 100% 10.800 7.560 N Syt6 n/a
4 TRCN0000379736 GGCTCACCCTCACAGTGATTA pLKO_005 1292 CDS 100% 13.200 9.240 N SYT6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001276680.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05010 pDONR223 100% 71.9% 71.4% None (many diffs) n/a
2 ccsbBroad304_05010 pLX_304 0% 71.9% 71.4% V5 (many diffs) n/a
3 TRCN0000471407 GGGTGCAAATAAAATGAGCCCCAC pLX_317 29.2% 71.9% 71.4% V5 (many diffs) n/a
Download CSV