Transcript: Human NM_001277742.1

Homo sapiens cytochrome P450 family 26 subfamily B member 1 (CYP26B1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
CYP26B1 (56603)
Length:
4342
CDS:
29..1342

Additional Resources:

NCBI RefSeq record:
NM_001277742.1
NBCI Gene record:
CYP26B1 (56603)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001277742.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064054 CGAGCTTGATGGTTTCCAGAT pLKO.1 940 CDS 100% 4.050 5.670 N CYP26B1 n/a
2 TRCN0000430859 GCCTCAGCGTCAAGTTCTTTG pLKO_005 1257 CDS 100% 10.800 7.560 N CYP26B1 n/a
3 TRCN0000423927 AGGTCTTCTCCAAGATCTTCA pLKO_005 231 CDS 100% 4.950 3.465 N CYP26B1 n/a
4 TRCN0000064056 CTTTGAGGTCTACCAGCAGTT pLKO.1 433 CDS 100% 4.050 2.835 N CYP26B1 n/a
5 TRCN0000064057 GAGCTGATCTTTGCGGCCTAT pLKO.1 677 CDS 100% 4.050 2.835 N CYP26B1 n/a
6 TRCN0000413471 TCAAAGACGTGAACGTGTTCG pLKO_005 1020 CDS 100% 4.050 2.835 N CYP26B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001277742.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03727 pDONR223 100% 85.3% 85.3% None 202_203ins225 n/a
2 ccsbBroad304_03727 pLX_304 0% 85.3% 85.3% V5 202_203ins225 n/a
Download CSV