Transcript: Mouse NM_001277756.1

Mus musculus caveolin 2 (Cav2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Cav2 (12390)
Length:
1116
CDS:
177..518

Additional Resources:

NCBI RefSeq record:
NM_001277756.1
NBCI Gene record:
Cav2 (12390)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001277756.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115357 GCTCTCTTTGAAATCAGCAAA pLKO.1 399 CDS 100% 4.950 3.960 N Cav2 n/a
2 TRCN0000115358 GCAGATCCTGAGAAGTATGTT pLKO.1 258 CDS 100% 5.625 3.938 N Cav2 n/a
3 TRCN0000115359 CCTGAGACTACACACTCCTTT pLKO.1 354 CDS 100% 4.950 3.465 N Cav2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001277756.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00227 pDONR223 100% 60.9% 62.9% None (many diffs) n/a
2 ccsbBroad304_00227 pLX_304 0% 60.9% 62.9% V5 (many diffs) n/a
Download CSV