Transcript: Mouse NM_001277876.1

Mus musculus tropomyosin 2, beta (Tpm2), transcript variant Tpm2.1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Tpm2 (22004)
Length:
2108
CDS:
201..1055

Additional Resources:

NCBI RefSeq record:
NM_001277876.1
NBCI Gene record:
Tpm2 (22004)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001277876.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108662 GAGGACTCAGACCGCAAATAT pLKO.1 666 CDS 100% 15.000 12.000 N Tpm2 n/a
2 TRCN0000424114 AGGAGGAGTATTCCACCAAAG pLKO_005 832 CDS 100% 6.000 4.800 N TPM2 n/a
3 TRCN0000072417 CGAGAGAGGAATGAAGGTCAT pLKO.1 569 CDS 100% 4.050 2.835 N TPM2 n/a
4 TRCN0000108663 GCTGAGGACTCAGACCGCAAA pLKO.1 663 CDS 100% 1.350 0.945 N Tpm2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001277876.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01702 pDONR223 100% 92.9% 99.2% None (many diffs) n/a
2 ccsbBroad304_01702 pLX_304 0% 92.9% 99.2% V5 (many diffs) n/a
Download CSV