Transcript: Human NM_001277961.1

Homo sapiens stromal interaction molecule 1 (STIM1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
STIM1 (6786)
Length:
4380
CDS:
569..2944

Additional Resources:

NCBI RefSeq record:
NM_001277961.1
NBCI Gene record:
STIM1 (6786)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001277961.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180131 CCACTCACAGTGGTTCTGTTT pLKO.1 3408 3UTR 100% 4.950 6.930 N STIM1 n/a
2 TRCN0000358716 CCTCTCTTGACTCGCCATAAT pLKO_005 1175 CDS 100% 13.200 9.240 N STIM1 n/a
3 TRCN0000358780 GTACAGTGGCTGATCACATAT pLKO_005 980 CDS 100% 13.200 9.240 N STIM1 n/a
4 TRCN0000358717 TGGTGGTGTCTATCGTTATTG pLKO_005 1215 CDS 100% 13.200 9.240 N STIM1 n/a
5 TRCN0000358718 ACATGAGGTGGAGGTGCAATA pLKO_005 1630 CDS 100% 10.800 7.560 N STIM1 n/a
6 TRCN0000443235 CACCTTCCATGGTGAGGATAA pLKO_005 886 CDS 100% 10.800 7.560 N Stim1 n/a
7 TRCN0000179490 GCTCTCCACATTTGGATTCTT pLKO.1 2706 CDS 100% 5.625 3.938 N STIM1 n/a
8 TRCN0000149588 CGATGAGATCAACCTTGCTAA pLKO.1 1429 CDS 100% 4.950 3.465 N STIM1 n/a
9 TRCN0000146686 CCTGGATGATGTAGATCATAA pLKO.1 1771 CDS 100% 1.320 0.924 N STIM1 n/a
10 TRCN0000358719 GGCTGCTGGTTTGCCTATATC pLKO_005 1244 CDS 100% 13.200 7.920 N STIM1 n/a
11 TRCN0000432705 GGCTGCTGGTTTGCCTATATC pLKO_005 1244 CDS 100% 13.200 7.920 N Stim1 n/a
12 TRCN0000432414 ATGACATGGATGAGGAGATTG pLKO_005 2001 CDS 100% 10.800 6.480 N Stim1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001277961.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.