Transcript: Human NM_001278116.2

Homo sapiens L1 cell adhesion molecule (L1CAM), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
L1CAM (3897)
Length:
5138
CDS:
218..3991

Additional Resources:

NCBI RefSeq record:
NM_001278116.2
NBCI Gene record:
L1CAM (3897)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278116.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063915 CCTTTAGGGTTACTGCCATAA pLKO.1 2274 CDS 100% 10.800 15.120 N L1CAM n/a
2 TRCN0000310751 GTCTCCGAAATGCTGTCTTTC pLKO_005 4294 3UTR 100% 10.800 15.120 N L1CAM n/a
3 TRCN0000303668 GTGCAACTTCAGGTTCCATAT pLKO_005 3343 CDS 100% 10.800 15.120 N L1CAM n/a
4 TRCN0000063917 GCCAATGCCTACATCTACGTT pLKO.1 1460 CDS 100% 3.000 4.200 N L1CAM n/a
5 TRCN0000299624 GCCAATGCCTACATCTACGTT pLKO_005 1460 CDS 100% 3.000 4.200 N L1CAM n/a
6 TRCN0000063913 CCACTTGTTTAAGGAGAGGAT pLKO.1 3481 CDS 100% 2.640 3.696 N L1CAM n/a
7 TRCN0000303735 TCGTGCCCTATGAGATCAAAG pLKO_005 2559 CDS 100% 10.800 8.640 N L1CAM n/a
8 TRCN0000063916 ACGGGCAACAACAGCAACTTT pLKO.1 509 CDS 100% 5.625 3.938 N L1CAM n/a
9 TRCN0000063914 GCTAACCTGAAGGTTAAAGAT pLKO.1 1745 CDS 100% 0.563 0.394 N L1CAM n/a
10 TRCN0000299625 GCTAACCTGAAGGTTAAAGAT pLKO_005 1745 CDS 100% 0.563 0.394 N L1CAM n/a
11 TRCN0000094552 CATATCTTGTTCAAAGCCTTA pLKO.1 3359 CDS 100% 4.050 2.835 N L1cam n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278116.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.