Transcript: Human NM_001278199.1

Homo sapiens sorting nexin 2 (SNX2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
SNX2 (6643)
Length:
7110
CDS:
1011..2219

Additional Resources:

NCBI RefSeq record:
NM_001278199.1
NBCI Gene record:
SNX2 (6643)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278199.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381031 GTGCTGCCATGTTAGGTAATT pLKO_005 1699 CDS 100% 13.200 18.480 N SNX2 n/a
2 TRCN0000382084 CAATAAGATTGTTGCCGTTAA pLKO_005 2220 CDS 100% 10.800 15.120 N SNX2 n/a
3 TRCN0000064993 CCCACAGAAGTTGTATTAGAT pLKO.1 840 5UTR 100% 5.625 7.875 N SNX2 n/a
4 TRCN0000299057 CCCACAGAAGTTGTATTAGAT pLKO_005 840 5UTR 100% 5.625 7.875 N SNX2 n/a
5 TRCN0000381982 GTGGACTGTGGCATGACATTC pLKO_005 2430 3UTR 100% 10.800 7.560 N SNX2 n/a
6 TRCN0000064997 GCTCAAATTACTTTGCTCAAA pLKO.1 1917 CDS 100% 4.950 3.465 N SNX2 n/a
7 TRCN0000064994 GCACAGCAAATTAGCAAGCAA pLKO.1 1229 CDS 100% 3.000 2.100 N SNX2 n/a
8 TRCN0000299055 GCACAGCAAATTAGCAAGCAA pLKO_005 1229 CDS 100% 3.000 2.100 N SNX2 n/a
9 TRCN0000064996 GCTGCAGTGAAAGGTGTGTTT pLKO.1 1860 CDS 100% 4.950 2.970 N SNX2 n/a
10 TRCN0000310351 GCTGCAGTGAAAGGTGTGTTT pLKO_005 1860 CDS 100% 4.950 2.970 N SNX2 n/a
11 TRCN0000138391 CGCCTGTAATCCTAGCACTTT pLKO.1 3317 3UTR 100% 4.950 2.475 Y DENND6A n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2348 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278199.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.