Transcript: Human NM_001278209.1

Homo sapiens nucleoporin 153 (NUP153), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
NUP153 (9972)
Length:
6030
CDS:
448..4968

Additional Resources:

NCBI RefSeq record:
NM_001278209.1
NBCI Gene record:
NUP153 (9972)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278209.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296605 GACAGTCTAAACTACGAAATA pLKO_005 1268 CDS 100% 13.200 18.480 N NUP153 n/a
2 TRCN0000102395 GCACGGTGAATGGCTTTGTAT pLKO.1 5260 3UTR 100% 5.625 7.875 N Nup153 n/a
3 TRCN0000060247 CCCAGTTTCTTTAACTCCATT pLKO.1 3513 CDS 100% 4.950 6.930 N NUP153 n/a
4 TRCN0000290594 CCCAGTTTCTTTAACTCCATT pLKO_005 3513 CDS 100% 4.950 6.930 N NUP153 n/a
5 TRCN0000060245 CGCAAGATAAAGACTGCTGTT pLKO.1 4933 CDS 100% 4.050 5.670 N NUP153 n/a
6 TRCN0000060243 GCCCTTACATTGACAGTGGTT pLKO.1 2809 CDS 100% 2.640 3.696 N NUP153 n/a
7 TRCN0000296547 TCTGCTGGTGGTGGCATATTT pLKO_005 4156 CDS 100% 15.000 10.500 N NUP153 n/a
8 TRCN0000308266 CATTGGTGTTGTACTCAATTT pLKO_005 4975 3UTR 100% 13.200 9.240 N NUP153 n/a
9 TRCN0000060246 CCTCTCCATCACCCATCAATT pLKO.1 2030 CDS 100% 13.200 9.240 N NUP153 n/a
10 TRCN0000060244 GCTACAAAGATACTTCAACAA pLKO.1 609 CDS 100% 4.950 3.465 N NUP153 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278209.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.