Transcript: Human NM_001278311.2

Homo sapiens DnaJ heat shock protein family (Hsp40) member B14 (DNAJB14), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
DNAJB14 (79982)
Length:
602
CDS:
48..377

Additional Resources:

NCBI RefSeq record:
NM_001278311.2
NBCI Gene record:
DNAJB14 (79982)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278311.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000335861 GCGATCAAAGCAAGCCTAATT pLKO_005 256 CDS 100% 13.200 18.480 N DNAJB14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278311.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04159 pDONR223 100% 28.4% 26.6% None (many diffs) n/a
2 ccsbBroad304_04159 pLX_304 0% 28.4% 26.6% V5 (many diffs) n/a
3 TRCN0000472243 TCTCTCTGACATTTTGCCTTCCTT pLX_317 39.2% 28.4% 26.6% V5 (many diffs) n/a
Download CSV