Transcript: Human NM_001278317.1

Homo sapiens F-box and leucine rich repeat protein 7 (FBXL7), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-25
Taxon:
Homo sapiens (human)
Gene:
FBXL7 (23194)
Length:
4352
CDS:
391..1725

Additional Resources:

NCBI RefSeq record:
NM_001278317.1
NBCI Gene record:
FBXL7 (23194)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278317.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118326 CTTTGTCAAACGCCACTGCAA pLKO.1 1665 CDS 100% 2.640 3.696 N FBXL7 n/a
2 TRCN0000118324 CCACCGAATCTCCCAGGATTT pLKO.1 430 CDS 100% 10.800 7.560 N FBXL7 n/a
3 TRCN0000118325 CCCTTGCATGGCAAACAGATT pLKO.1 1045 CDS 100% 4.950 3.465 N FBXL7 n/a
4 TRCN0000118322 CCGGCGTTGTATTCACACAAA pLKO.1 1741 3UTR 100% 4.950 3.465 N FBXL7 n/a
5 TRCN0000118323 GCATCTCATCTGACGTGAGTT pLKO.1 302 5UTR 100% 4.950 3.465 N FBXL7 n/a
6 TRCN0000087610 GCAAACAGATTTCCATCCGAT pLKO.1 1055 CDS 100% 2.640 1.848 N Fbxl7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278317.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02733 pDONR223 100% 90.4% 90.4% None 0_1ins141 n/a
2 ccsbBroad304_02733 pLX_304 0% 90.4% 90.4% V5 0_1ins141 n/a
Download CSV