Transcript: Human NM_001278344.1

Homo sapiens actinin alpha 2 (ACTN2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
ACTN2 (88)
Length:
5123
CDS:
1042..3102

Additional Resources:

NCBI RefSeq record:
NM_001278344.1
NBCI Gene record:
ACTN2 (88)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278344.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055868 CGCTTTGCTATTCAGGATATT pLKO.1 638 5UTR 100% 13.200 18.480 N ACTN2 n/a
2 TRCN0000427202 GCAAGATGGTGTCGGATATTG pLKO_005 1511 CDS 100% 13.200 9.240 N ACTN2 n/a
3 TRCN0000435058 GACCTCATTGACTACTCAAAG pLKO_005 806 5UTR 100% 10.800 7.560 N ACTN2 n/a
4 TRCN0000055870 GAATGGAGAAATTGCTAGAAA pLKO.1 1934 CDS 100% 5.625 3.938 N ACTN2 n/a
5 TRCN0000055871 GAGCACAACATCATCAACTAT pLKO.1 2461 CDS 100% 5.625 3.938 N ACTN2 n/a
6 TRCN0000055872 CGACGAGGATGAGTACATGAT pLKO.1 262 5UTR 100% 4.950 3.465 N ACTN2 n/a
7 TRCN0000055869 GCCTGATGGATCATGAGGATT pLKO.1 2729 CDS 100% 4.950 3.465 N ACTN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278344.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00017 pDONR223 100% 69.7% 69.7% None 0_1ins735;48_158del n/a
2 ccsbBroad304_00017 pLX_304 0% 69.7% 69.7% V5 0_1ins735;48_158del n/a
Download CSV