Transcript: Human NM_001278351.2

Homo sapiens fibroblast growth factor receptor substrate 2 (FRS2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
FRS2 (10818)
Length:
6950
CDS:
586..2112

Additional Resources:

NCBI RefSeq record:
NM_001278351.2
NBCI Gene record:
FRS2 (10818)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278351.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370439 CATTGCTAACAGGTAACTATA pLKO_005 2480 3UTR 100% 13.200 18.480 N FRS2 n/a
2 TRCN0000061721 CCGTGATAGACATCGAGAGAA pLKO.1 2000 CDS 100% 4.950 6.930 N FRS2 n/a
3 TRCN0000061720 CGCAAGCTAAGTAGGGATGAA pLKO.1 1669 CDS 100% 4.950 6.930 N FRS2 n/a
4 TRCN0000301020 CGCAAGCTAAGTAGGGATGAA pLKO_005 1669 CDS 100% 4.950 6.930 N FRS2 n/a
5 TRCN0000061718 CGGAACAAGTTTAAGGTCATT pLKO.1 637 CDS 100% 4.950 6.930 N FRS2 n/a
6 TRCN0000301022 CGGAACAAGTTTAAGGTCATT pLKO_005 637 CDS 100% 4.950 6.930 N FRS2 n/a
7 TRCN0000061719 CCCGTGCAGAAGAATTATTTA pLKO.1 860 CDS 100% 15.000 10.500 N FRS2 n/a
8 TRCN0000370440 CTCTAAATGGCTACCATAATA pLKO_005 1718 CDS 100% 15.000 10.500 N FRS2 n/a
9 TRCN0000061722 CGCTATGGCTATGACTCGAAT pLKO.1 775 CDS 100% 4.950 3.465 N FRS2 n/a
10 TRCN0000331475 CGCTATGGCTATGACTCGAAT pLKO_005 775 CDS 100% 4.950 3.465 N FRS2 n/a
11 TRCN0000097283 CATCTCTAAATGGCTACCATA pLKO.1 1715 CDS 100% 4.950 2.970 N Frs2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278351.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07687 pDONR223 100% 99.1% 99.2% None 654G>A;1524_1525insTTAGCCTGGAAA n/a
2 ccsbBroad304_07687 pLX_304 40.6% 99.1% 99.2% V5 654G>A;1524_1525insTTAGCCTGGAAA n/a
Download CSV