Transcript: Human NM_001278913.2

Homo sapiens elastin (ELN), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ELN (2006)
Length:
3154
CDS:
16..1947

Additional Resources:

NCBI RefSeq record:
NM_001278913.2
NBCI Gene record:
ELN (2006)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278913.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432800 GCTTCGGATTGTCTCCCATTT pLKO_005 1877 CDS 100% 10.800 15.120 N ELN n/a
2 TRCN0000437566 CACGCTGGTGCTCTTATCTTC pLKO_005 2252 3UTR 100% 4.950 6.930 N ELN n/a
3 TRCN0000116962 GCCGCTAAAGCAGCCAAATAT pLKO.1 1537 CDS 100% 15.000 12.000 N ELN n/a
4 TRCN0000116963 CAGCCGCTAAAGCAGCTAAAT pLKO.1 1781 CDS 100% 13.200 10.560 N ELN n/a
5 TRCN0000437263 CAACGTTGGTGCTACTGCTTG pLKO_005 1979 3UTR 100% 4.050 3.240 N ELN n/a
6 TRCN0000116964 TGCCGCTAAAGCAGCCAAATA pLKO.1 1536 CDS 100% 13.200 9.240 N ELN n/a
7 TRCN0000116966 GCCGGAGTGAAGCCTGGGAAA pLKO.1 379 CDS 100% 0.000 0.000 N ELN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278913.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.