Transcript: Human NM_001281463.1

Homo sapiens structural maintenance of chromosomes 1A (SMC1A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
SMC1A (8243)
Length:
9930
CDS:
341..3976

Additional Resources:

NCBI RefSeq record:
NM_001281463.1
NBCI Gene record:
SMC1A (8243)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001281463.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062555 GCCGGGACTGTATTCAGTATA pLKO.1 1932 CDS 100% 13.200 18.480 N SMC1A n/a
2 TRCN0000299440 GCCGGGACTGTATTCAGTATA pLKO_005 1932 CDS 100% 13.200 18.480 N SMC1A n/a
3 TRCN0000303680 CAACTTTGGGCCTCGCATTAA pLKO_005 2500 CDS 100% 13.200 9.240 N SMC1A n/a
4 TRCN0000303646 CCTGAACGACAGGGAGTATTC pLKO_005 4157 3UTR 100% 10.800 7.560 N SMC1A n/a
5 TRCN0000062554 CGACAGATTATCGGACCATTT pLKO.1 180 5UTR 100% 10.800 7.560 N SMC1A n/a
6 TRCN0000299515 CGACAGATTATCGGACCATTT pLKO_005 180 5UTR 100% 10.800 7.560 N SMC1A n/a
7 TRCN0000062553 CGGCGTATTGATGAAATCAAT pLKO.1 1676 CDS 100% 0.563 0.394 N SMC1A n/a
8 TRCN0000062557 CCAACATTGATGAGATCTATA pLKO.1 3510 CDS 100% 13.200 7.920 N SMC1A n/a
9 TRCN0000299517 CCAACATTGATGAGATCTATA pLKO_005 3510 CDS 100% 13.200 7.920 N SMC1A n/a
10 TRCN0000062556 CCAACAAGGAAATGACCCATT pLKO.1 2976 CDS 100% 4.050 2.430 N SMC1A n/a
11 TRCN0000165205 GCCTCAGTTTCCTCATCTGTA pLKO.1 4872 3UTR 100% 4.950 2.475 Y YIF1B n/a
12 TRCN0000160434 CAGTTTCCTCATCTGTAAATA pLKO.1 4876 3UTR 100% 15.000 7.500 Y YIF1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001281463.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.