Transcript: Human NM_001281789.1

Homo sapiens CTD nuclear envelope phosphatase 1 regulatory subunit 1 (CNEP1R1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
CNEP1R1 (255919)
Length:
2150
CDS:
111..488

Additional Resources:

NCBI RefSeq record:
NM_001281789.1
NBCI Gene record:
CNEP1R1 (255919)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001281789.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167773 GAGGAGACTTACTGAATATAT pLKO.1 152 CDS 100% 15.000 21.000 N CNEP1R1 n/a
2 TRCN0000245538 GCTCGATGTCGAACGGTATTA pLKO_005 399 CDS 100% 13.200 18.480 N CNEP1R1 n/a
3 TRCN0000253539 GCTCGATGTCGAACGGTATTA pLKO_005 399 CDS 100% 13.200 18.480 N Cnep1r1 n/a
4 TRCN0000245535 TAATAGCCGCATGTACTATAA pLKO_005 1727 3UTR 100% 13.200 10.560 N CNEP1R1 n/a
5 TRCN0000245537 AGAGTAGTTGCACCATCAATT pLKO_005 372 CDS 100% 13.200 9.240 N CNEP1R1 n/a
6 TRCN0000245536 TGGTGCCTGGAACTGGTTAAT pLKO_005 242 CDS 100% 13.200 9.240 N CNEP1R1 n/a
7 TRCN0000245539 TTAGCTGTATCACTCTAATAG pLKO_005 325 CDS 100% 13.200 9.240 N CNEP1R1 n/a
8 TRCN0000167383 GAATGCTTCTTATAGTGGTAT pLKO.1 205 CDS 100% 4.950 3.465 N CNEP1R1 n/a
9 TRCN0000166967 GCAGATGAAGTATGTATGTAT pLKO.1 736 3UTR 100% 5.625 3.375 N CNEP1R1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001281789.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.