Transcript: Mouse NM_001282071.2

Mus musculus surfactant associated protein B (Sftpb), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Mus musculus (mouse)
Gene:
Sftpb (20388)
Length:
1492
CDS:
16..1080

Additional Resources:

NCBI RefSeq record:
NM_001282071.2
NBCI Gene record:
Sftpb (20388)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001282071.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000445070 ACTCTGATCAAGCGGGTTCAA pLKO_005 625 CDS 100% 4.950 6.930 N Sftpb n/a
2 TRCN0000054947 CCATTTCTGCAAGTCTGTGAT pLKO.1 831 CDS 100% 4.950 3.465 N Sftpb n/a
3 TRCN0000054946 CGGAAGTTCCTGGAACAAGAA pLKO.1 289 CDS 100% 4.950 3.465 N Sftpb n/a
4 TRCN0000054943 AGTCTGTATGTCCCAGCTCTA pLKO.1 1142 3UTR 100% 4.050 2.835 N Sftpb n/a
5 TRCN0000054945 GCCCTCAATTCTGGTGCCAAA pLKO.1 116 CDS 100% 4.050 2.835 N Sftpb n/a
6 TRCN0000054944 CCTCCTCACAAAGATGACCAA pLKO.1 243 CDS 100% 2.640 1.848 N Sftpb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282071.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.