Transcript: Human NM_001282147.1

Homo sapiens spermatogenesis and oogenesis specific basic helix-loop-helix 2 (SOHLH2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
SOHLH2 (54937)
Length:
1936
CDS:
90..767

Additional Resources:

NCBI RefSeq record:
NM_001282147.1
NBCI Gene record:
SOHLH2 (54937)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282147.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015771 CCTGGCTGATACTGTACAGAA pLKO.1 182 CDS 100% 4.950 2.475 Y SOHLH2 n/a
2 TRCN0000015769 GCTTGAATTAAATGCTTCGTT pLKO.1 647 CDS 100% 3.000 1.500 Y SOHLH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282147.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12116 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12116 pLX_304 0% 100% 100% V5 n/a
Download CSV