Transcript: Human NM_001282333.1

Homo sapiens tRNA splicing endonuclease subunit 34 (TSEN34), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
TSEN34 (79042)
Length:
1912
CDS:
100..1047

Additional Resources:

NCBI RefSeq record:
NM_001282333.1
NBCI Gene record:
TSEN34 (79042)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282333.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063656 GCGCTACAGTATCTACAGAGA pLKO.1 765 CDS 100% 2.640 3.696 N TSEN34 n/a
2 TRCN0000288674 GCGCTACAGTATCTACAGAGA pLKO_005 765 CDS 100% 2.640 3.696 N TSEN34 n/a
3 TRCN0000063655 CCCATTATATCGCTCAGTGCT pLKO.1 875 CDS 100% 2.640 2.112 N TSEN34 n/a
4 TRCN0000295887 TCCCAAGCAGGACCCTCAAAT pLKO_005 607 CDS 100% 13.200 9.240 N TSEN34 n/a
5 TRCN0000295832 GAGGTGACTTCCTGGTCTATC pLKO_005 830 CDS 100% 10.800 7.560 N TSEN34 n/a
6 TRCN0000295834 GGAGCTCCTGGAGAAGATTAC pLKO_005 438 CDS 100% 10.800 7.560 N TSEN34 n/a
7 TRCN0000063653 GCTGCTAAGAAGCAGAAACTA pLKO.1 469 CDS 100% 0.563 0.394 N TSEN34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282333.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12535 pDONR223 100% 77% 70.7% None (many diffs) n/a
2 ccsbBroad304_12535 pLX_304 0% 77% 70.7% V5 (many diffs) n/a
Download CSV