Transcript: Human NM_001282613.1

Homo sapiens bestrophin 3 (BEST3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
BEST3 (144453)
Length:
3292
CDS:
284..1972

Additional Resources:

NCBI RefSeq record:
NM_001282613.1
NBCI Gene record:
BEST3 (144453)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282613.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154922 GCAACTAAAGCCCGGAATGAA pLKO.1 539 CDS 100% 5.625 4.500 N BEST3 n/a
2 TRCN0000152036 CCACAGTGATTTAGCCAAATA pLKO.1 2207 3UTR 100% 13.200 9.240 N BEST3 n/a
3 TRCN0000152775 GACGAAATGCACATGAGCTTA pLKO.1 932 CDS 100% 4.950 3.465 N BEST3 n/a
4 TRCN0000124476 TGGTGGAACCAGTTTGTGAAT pLKO.1 242 5UTR 100% 4.950 3.465 N Best3 n/a
5 TRCN0000151289 CCAAGATGAAGAAGGACATTT pLKO.1 954 CDS 100% 13.200 7.920 N BEST3 n/a
6 TRCN0000151464 CGAAGCCAAGAGAATATGAAA pLKO.1 2906 3UTR 100% 5.625 3.375 N BEST3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282613.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13225 pDONR223 93.6% 12.1% 9.8% None (many diffs) n/a
Download CSV