Transcript: Human NM_001282622.2

Homo sapiens lysine demethylase 5C (KDM5C), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
KDM5C (8242)
Length:
6644
CDS:
319..4998

Additional Resources:

NCBI RefSeq record:
NM_001282622.2
NBCI Gene record:
KDM5C (8242)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282622.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358546 CCACTACGAACGCATTGTTTA pLKO_005 783 CDS 100% 13.200 18.480 N KDM5C n/a
2 TRCN0000234961 GCCACACTTGAGGCCATAATC pLKO_005 3313 CDS 100% 13.200 18.480 N KDM5C n/a
3 TRCN0000022088 TCGCAGAGAAATCGGGCATTT pLKO.1 428 CDS 100% 10.800 15.120 N KDM5C n/a
4 TRCN0000234958 TCGCAGAGAAATCGGGCATTT pLKO_005 428 CDS 100% 10.800 15.120 N KDM5C n/a
5 TRCN0000022085 CCCACTACGAACGCATTGTTT pLKO.1 782 CDS 100% 5.625 7.875 N KDM5C n/a
6 TRCN0000022087 GTGACAGTAAACGGCACCTAA pLKO.1 1682 CDS 100% 4.950 3.960 N KDM5C n/a
7 TRCN0000358547 CTAGCCCTGCTGTGGATAAAG pLKO_005 3200 CDS 100% 13.200 9.240 N KDM5C n/a
8 TRCN0000358548 CTCACTTGCAGCAGAACATTT pLKO_005 1929 CDS 100% 13.200 9.240 N KDM5C n/a
9 TRCN0000234962 GGTTCCAACTGAAGCCTATTT pLKO_005 5725 3UTR 100% 13.200 9.240 N KDM5C n/a
10 TRCN0000358549 GAGCTGCTGCAGCAACTAAAG pLKO_005 2743 CDS 100% 10.800 7.560 N KDM5C n/a
11 TRCN0000097857 CGCATTGTTTATCCCTATGAA pLKO.1 793 CDS 100% 5.625 3.938 N Kdm5c n/a
12 TRCN0000287995 CGCATTGTTTATCCCTATGAA pLKO_005 793 CDS 100% 5.625 3.938 N Kdm5c n/a
13 TRCN0000097856 GCATTGTTTATCCCTATGAAA pLKO.1 794 CDS 100% 5.625 3.938 N Kdm5c n/a
14 TRCN0000234960 AGTACCTGCGGTATCGGTATA pLKO_005 2549 CDS 100% 10.800 6.480 N KDM5C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282622.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.