Transcript: Human NM_001282652.1

Homo sapiens stress induced phosphoprotein 1 (STIP1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
STIP1 (10963)
Length:
2766
CDS:
554..2326

Additional Resources:

NCBI RefSeq record:
NM_001282652.1
NBCI Gene record:
STIP1 (10963)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282652.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243097 GTGCTACTCCGAAGCTATTAA pLKO_005 769 CDS 100% 15.000 21.000 N STIP1 n/a
2 TRCN0000243098 ACCCGAAAGATGCCAAATTAT pLKO_005 1863 CDS 100% 15.000 12.000 N STIP1 n/a
3 TRCN0000243095 TACCAATCAAGCAGCGGTATA pLKO_005 1480 CDS 100% 0.000 0.000 N STIP1 n/a
4 TRCN0000243096 CGACCTTCATCAAGGGTTATA pLKO_005 1968 CDS 100% 13.200 9.240 N STIP1 n/a
5 TRCN0000148341 CGAACACTTAAAGAATCCTGT pLKO.1 2251 CDS 100% 2.640 1.848 N STIP1 n/a
6 TRCN0000243099 AGGCCTCATCTCTCTATATTT pLKO_005 2423 3UTR 100% 15.000 9.000 N STIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282652.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02577 pDONR223 100% 91.9% 91.5% None 1_135delinsA;142_149delCTGAGATGinsA n/a
2 ccsbBroad304_02577 pLX_304 0% 91.9% 91.5% V5 1_135delinsA;142_149delCTGAGATGinsA n/a
Download CSV