Transcript: Human NM_001282658.2

Homo sapiens coiled-coil domain containing 3 (CCDC3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
CCDC3 (83643)
Length:
3519
CDS:
1291..1728

Additional Resources:

NCBI RefSeq record:
NM_001282658.2
NBCI Gene record:
CCDC3 (83643)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282658.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428571 TTTCGTACATGCAGCTATTTC pLKO_005 1790 3UTR 100% 13.200 18.480 N CCDC3 n/a
2 TRCN0000133751 CGCATTTGGTAGAGTCTAAAT pLKO.1 1841 3UTR 100% 13.200 10.560 N CCDC3 n/a
3 TRCN0000137060 CCACCACTTCATTAGCTGTAT pLKO.1 3292 3UTR 100% 4.950 3.465 N CCDC3 n/a
4 TRCN0000134649 GCTGTGTGATTAAGAAGTCAA pLKO.1 2904 3UTR 100% 4.950 3.465 N CCDC3 n/a
5 TRCN0000138310 CTTTCTCCAGTGACTGGGAAA pLKO.1 1427 CDS 100% 4.050 2.835 N CCDC3 n/a
6 TRCN0000138240 CCTCACGGAGTCAATTTCCAA pLKO.1 1315 CDS 100% 3.000 2.100 N CCDC3 n/a
7 TRCN0000138208 CCAGAAACTCAGTGAGAAGCT pLKO.1 1641 CDS 100% 2.640 1.848 N CCDC3 n/a
8 TRCN0000138226 CGAACCAGAAACTCAGTGAGA pLKO.1 1637 CDS 100% 2.640 1.848 N CCDC3 n/a
9 TRCN0000138774 GAAGAAGGTCAAGAGGTCCTT pLKO.1 1578 CDS 100% 2.640 1.848 N CCDC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282658.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.