Transcript: Human NM_001282662.3

Homo sapiens myocardin related transcription factor A (MRTFA), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
MRTFA (57591)
Length:
4532
CDS:
326..3022

Additional Resources:

NCBI RefSeq record:
NM_001282662.3
NBCI Gene record:
MRTFA (57591)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282662.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303841 TTGTGGGCCAGGTGAACTATC pLKO_005 924 CDS 100% 10.800 8.640 N MRTFA n/a
2 TRCN0000083564 CCTCACCAATGGAACCACTAT pLKO.1 1198 CDS 100% 4.950 3.960 N MRTFA n/a
3 TRCN0000303842 CTGTCTGTCTGGCTACAATTT pLKO_005 3727 3UTR 100% 13.200 9.240 N MRTFA n/a
4 TRCN0000083565 GACTATCTCAAACGGAAGATT pLKO.1 695 CDS 100% 5.625 3.938 N MRTFA n/a
5 TRCN0000299977 GACTATCTCAAACGGAAGATT pLKO_005 695 CDS 100% 5.625 3.938 N MRTFA n/a
6 TRCN0000083567 GCTCAAGTACCACCAGTACAT pLKO.1 1330 CDS 100% 4.950 3.465 N MRTFA n/a
7 TRCN0000299978 GCTCAAGTACCACCAGTACAT pLKO_005 1330 CDS 100% 4.950 3.465 N MRTFA n/a
8 TRCN0000083566 CGCCACCTCTATCCTGCACAA pLKO.1 1810 CDS 100% 1.350 0.945 N MRTFA n/a
9 TRCN0000303789 TTCCTCGATGGCCATGATTTG pLKO_005 3384 3UTR 100% 10.800 6.480 N MRTFA n/a
10 TRCN0000085244 CCAAAGGTGAAGAAGCTCAAA pLKO.1 1316 CDS 100% 4.950 2.970 N Myocd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282662.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.