Transcript: Human NM_001282683.2

Homo sapiens F-box protein 31 (FBXO31), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
FBXO31 (79791)
Length:
5732
CDS:
328..1431

Additional Resources:

NCBI RefSeq record:
NM_001282683.2
NBCI Gene record:
FBXO31 (79791)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282683.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437841 AGTGCATGTACGGCCACAAAG pLKO_005 425 CDS 100% 10.800 8.640 N FBXO31 n/a
2 TRCN0000438748 GCGAAGCTGCTTCACCGATAT pLKO_005 217 5UTR 100% 10.800 8.640 N FBXO31 n/a
3 TRCN0000412340 GTGACATAGACCTGCATATTT pLKO_005 1594 3UTR 100% 15.000 10.500 N FBXO31 n/a
4 TRCN0000122638 GCCTCAGTGCATTTGGCAAAT pLKO.1 2869 3UTR 100% 10.800 7.560 N FBXO31 n/a
5 TRCN0000122047 CCTTGAAGATTCACCATTGTT pLKO.1 3221 3UTR 100% 5.625 3.938 N FBXO31 n/a
6 TRCN0000433748 AGCTGAGCATGTCTTACCAAA pLKO_005 1635 3UTR 100% 4.950 3.465 N FBXO31 n/a
7 TRCN0000122856 GTTCATCTACACCAGTCAGTA pLKO.1 630 CDS 100% 4.950 3.465 N FBXO31 n/a
8 TRCN0000141901 GAAGGATGAGTTCTCCACCAA pLKO.1 477 CDS 100% 2.640 1.848 N FBXO31 n/a
9 TRCN0000141663 CCCTATGAGATTCAAGCCTCT pLKO.1 363 CDS 100% 2.160 1.512 N FBXO31 n/a
10 TRCN0000142127 GCTCAAGAACATTCAGTCCCT pLKO.1 1401 CDS 100% 0.660 0.462 N FBXO31 n/a
11 TRCN0000122855 GCTGAAATCCTTCAGCCTGTA pLKO.1 1317 CDS 100% 0.405 0.284 N FBXO31 n/a
12 TRCN0000142835 CCATATGAGATGACGAGGAAA pLKO.1 2364 3UTR 100% 0.000 0.000 N FBXO31 n/a
13 TRCN0000145289 GATTGTGAAGAAGGATGAGTT pLKO.1 468 CDS 100% 4.950 2.970 N FBXO31 n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5301 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5301 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282683.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.