Transcript: Human NM_001282723.1

Homo sapiens lipid droplet associated hydrolase (LDAH), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
LDAH (60526)
Length:
3728
CDS:
97..597

Additional Resources:

NCBI RefSeq record:
NM_001282723.1
NBCI Gene record:
LDAH (60526)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282723.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129839 CCAGCCATTAAGTTATGTGAA pLKO.1 1901 3UTR 100% 4.950 3.960 N LDAH n/a
2 TRCN0000149527 GCTCCCAAAGACAAGAAGATT pLKO.1 358 CDS 100% 5.625 3.938 N LDAH n/a
3 TRCN0000130311 GAGGATTCAAACGCTCAAGAA pLKO.1 391 CDS 100% 4.950 3.465 N LDAH n/a
4 TRCN0000129885 GCCATACATTAACTCTCCATT pLKO.1 1828 3UTR 100% 4.950 3.465 N LDAH n/a
5 TRCN0000149469 GCCATGTTATAGGCTGAAGTA pLKO.1 983 3UTR 100% 4.950 3.465 N LDAH n/a
6 TRCN0000148482 CCTAAAGGATGACTTGTCCAA pLKO.1 812 3UTR 100% 2.640 1.848 N LDAH n/a
7 TRCN0000127675 CCTCATGCTTTCATCACCCAT pLKO.1 756 3UTR 100% 2.640 1.848 N LDAH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282723.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08801 pDONR223 100% 49.6% 48.9% None (many diffs) n/a
2 ccsbBroad304_08801 pLX_304 0% 49.6% 48.9% V5 (many diffs) n/a
Download CSV