Transcript: Human NM_001282738.1

Homo sapiens oxysterol binding protein 2 (OSBP2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
OSBP2 (23762)
Length:
4026
CDS:
280..2532

Additional Resources:

NCBI RefSeq record:
NM_001282738.1
NBCI Gene record:
OSBP2 (23762)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282738.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437430 CGCACTTAGCAGACAGCTTTC pLKO_005 2963 3UTR 100% 6.000 8.400 N OSBP2 n/a
2 TRCN0000437212 AGCGCCACCCTTGCAACAAAT pLKO_005 2532 CDS 100% 13.200 10.560 N OSBP2 n/a
3 TRCN0000421321 GTTCATTAATGCACTCAATTT pLKO_005 2581 3UTR 100% 13.200 9.240 N OSBP2 n/a
4 TRCN0000413035 ATGAAGATACCGAGTACTTTG pLKO_005 1124 CDS 100% 10.800 7.560 N OSBP2 n/a
5 TRCN0000151993 CATCACATCCAATGCTATGAT pLKO.1 867 CDS 100% 5.625 3.938 N OSBP2 n/a
6 TRCN0000153631 CAAGGGTTCATCCAAAGTCAA pLKO.1 1284 CDS 100% 4.950 3.465 N OSBP2 n/a
7 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 88 5UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282738.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.