Transcript: Human NM_001282793.1

Homo sapiens filamin A interacting protein 1 like (FILIP1L), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
FILIP1L (11259)
Length:
2521
CDS:
295..2430

Additional Resources:

NCBI RefSeq record:
NM_001282793.1
NBCI Gene record:
FILIP1L (11259)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282793.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136993 CCATTGAAAGTCGGCTAGAAA pLKO.1 443 CDS 100% 5.625 7.875 N FILIP1L n/a
2 TRCN0000431196 CAGTGCCAAGCATGCGATATT pLKO_005 2097 CDS 100% 13.200 10.560 N FILIP1L n/a
3 TRCN0000136171 GCAATAGCTCAAGTGTGATAA pLKO.1 2168 CDS 100% 13.200 10.560 N FILIP1L n/a
4 TRCN0000136305 GCTAAGTACAAGTTAGCAGAA pLKO.1 1075 CDS 100% 0.405 0.324 N FILIP1L n/a
5 TRCN0000346916 TGATAACTACTGAGGATAATA pLKO_005 2183 CDS 100% 15.000 10.500 N Filip1l n/a
6 TRCN0000426994 ATGGCAACTGAAGACCTAATA pLKO_005 1210 CDS 100% 13.200 9.240 N FILIP1L n/a
7 TRCN0000137442 GCAGTCATCAATGGTCAGTTA pLKO.1 1483 CDS 100% 4.950 3.465 N FILIP1L n/a
8 TRCN0000136529 CCAATAAAGTCACCAGCAGTA pLKO.1 2333 CDS 100% 4.050 2.835 N FILIP1L n/a
9 TRCN0000136191 GCTTCAATCATTGGAAGCAAT pLKO.1 795 CDS 100% 0.495 0.347 N FILIP1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282793.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02661 pDONR223 100% 78.6% 78.6% None (many diffs) n/a
2 ccsbBroad304_02661 pLX_304 0% 78.6% 78.6% V5 (many diffs) n/a
Download CSV