Transcript: Mouse NM_001282994.1

Mus musculus cordon-bleu WH2 repeat (Cobl), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Cobl (12808)
Length:
5464
CDS:
91..4083

Additional Resources:

NCBI RefSeq record:
NM_001282994.1
NBCI Gene record:
Cobl (12808)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001282994.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178003 GTGCATACTGTACTTCTGAAA pLKO.1 454 CDS 100% 4.950 6.930 N Cobl n/a
2 TRCN0000182856 CCAACTCACCATCCTTGCATT pLKO.1 944 CDS 100% 4.950 3.960 N Cobl n/a
3 TRCN0000182082 CGAAACAGACACTCCACCTAT pLKO.1 2565 CDS 100% 4.950 3.960 N Cobl n/a
4 TRCN0000177543 CCAAGTATCATCACTTTAGAA pLKO.1 4117 3UTR 100% 5.625 3.938 N Cobl n/a
5 TRCN0000177705 CCACAGTTACATCACTTGTTT pLKO.1 2180 CDS 100% 5.625 3.938 N Cobl n/a
6 TRCN0000198686 CCCACAGTTACATCACTTGTT pLKO.1 2179 CDS 100% 4.950 3.465 N Cobl n/a
7 TRCN0000198735 CCCAGTTCGTTATCTACAGAT pLKO.1 3505 CDS 100% 4.950 3.465 N Cobl n/a
8 TRCN0000182558 GCAACCACTGAACAGTGTCAT pLKO.1 2971 CDS 100% 4.950 3.465 N Cobl n/a
9 TRCN0000181669 GCAGTCTCTTGTTCTGTGAAA pLKO.1 2815 CDS 100% 4.950 3.465 N Cobl n/a
10 TRCN0000182450 GCAATGATGGACCTACTGGTT pLKO.1 319 CDS 100% 2.640 1.848 N Cobl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282994.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.