Transcript: Human NM_001284194.1

Homo sapiens fucosyltransferase 11 (FUT11), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-02-24
Taxon:
Homo sapiens (human)
Gene:
FUT11 (170384)
Length:
2191
CDS:
44..1474

Additional Resources:

NCBI RefSeq record:
NM_001284194.1
NBCI Gene record:
FUT11 (170384)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001284194.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425147 GGCTTTCTTGTCCCGCTATAA pLKO_005 847 CDS 100% 13.200 18.480 N FUT11 n/a
2 TRCN0000035676 CGTCATCCTGATTGATGATTT pLKO.1 1003 CDS 100% 1.320 1.056 N FUT11 n/a
3 TRCN0000414693 GATGTGGCTGCAAGATTATTG pLKO_005 1509 3UTR 100% 13.200 9.240 N FUT11 n/a
4 TRCN0000416256 GCGGAGCTAAGGAGATCTTAT pLKO_005 1671 3UTR 100% 13.200 9.240 N FUT11 n/a
5 TRCN0000035677 CACTGCCATGATCCACAACAA pLKO.1 1557 3UTR 100% 4.950 3.465 N FUT11 n/a
6 TRCN0000035674 GCTGGCAGAGTTTATTGACTT pLKO.1 1039 CDS 100% 4.950 3.465 N FUT11 n/a
7 TRCN0000035678 CTTCAATCTTACCTCCACCTT pLKO.1 535 CDS 100% 2.640 1.848 N FUT11 n/a
8 TRCN0000035675 CCTACATGAAATCTTCATGAA pLKO.1 1608 3UTR 100% 0.495 0.347 N FUT11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001284194.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.