Transcript: Human NM_001284351.3

Homo sapiens solute carrier family 9 member A3 (SLC9A3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SLC9A3 (6550)
Length:
5528
CDS:
128..2605

Additional Resources:

NCBI RefSeq record:
NM_001284351.3
NBCI Gene record:
SLC9A3 (6550)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001284351.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044706 AGGAATTGACAACCCTGTGTT pLKO.1 2350 CDS 100% 4.950 3.465 N SLC9A3 n/a
2 TRCN0000044707 CACCACCATCATCGTAGTGTT pLKO.1 1444 CDS 100% 4.950 3.465 N SLC9A3 n/a
3 TRCN0000044703 CGAGACCATCATCTTCATGTT pLKO.1 1165 CDS 100% 4.950 3.465 N SLC9A3 n/a
4 TRCN0000044704 GCACAATTATCTCAGAGACAA pLKO.1 1597 CDS 100% 4.950 3.465 N SLC9A3 n/a
5 TRCN0000044705 GCCGTGTTTGAGGAGGTCCAT pLKO.1 719 CDS 100% 0.880 0.616 N SLC9A3 n/a
6 TRCN0000183259 GCCTACTTTGTGATAGACTAT pLKO.1 5133 3UTR 100% 4.950 2.475 Y PP7080 n/a
7 TRCN0000179859 CAGGAGGAGTTCTTAAAGAGT pLKO.1 4042 3UTR 100% 3.000 1.500 Y PP7080 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001284351.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.