Transcript: Mouse NM_001285793.1

Mus musculus UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 4 (B4galt4), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
B4galt4 (56375)
Length:
2381
CDS:
323..1357

Additional Resources:

NCBI RefSeq record:
NM_001285793.1
NBCI Gene record:
B4galt4 (56375)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001285793.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018781 GCTGGACTACGGCATCTATAT pLKO.1 778 CDS 100% 13.200 18.480 N B4galt4 n/a
2 TRCN0000018780 GCACAACCCTTTATATGCCAA pLKO.1 1306 CDS 100% 2.640 3.696 N B4galt4 n/a
3 TRCN0000018779 GAATGGATTCTCTAACAACTA pLKO.1 1060 CDS 100% 4.950 3.960 N B4galt4 n/a
4 TRCN0000018777 GCTAGTTTCCACAAGGTCATA pLKO.1 467 CDS 100% 4.950 3.960 N B4galt4 n/a
5 TRCN0000018778 CGTGGGCAAATACACCATGAT pLKO.1 1162 CDS 100% 4.950 3.465 N B4galt4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001285793.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.