Transcript: Mouse NM_001285835.1

Mus musculus NADPH oxidase 4 (Nox4), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Nox4 (50490)
Length:
3756
CDS:
416..1930

Additional Resources:

NCBI RefSeq record:
NM_001285835.1
NBCI Gene record:
Nox4 (50490)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001285835.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076583 GCATCAAATAACCACCTGTAT pLKO.1 3185 3UTR 100% 4.950 6.930 N Nox4 n/a
2 TRCN0000076584 GCCAGTATATTATTCTCCATT pLKO.1 1200 CDS 100% 4.950 6.930 N Nox4 n/a
3 TRCN0000076585 CCTACGCAATAAGAGTTTCTA pLKO.1 729 CDS 100% 5.625 3.938 N Nox4 n/a
4 TRCN0000076586 GCATTAGTCTTAACCAGACAT pLKO.1 870 CDS 100% 4.950 3.465 N Nox4 n/a
5 TRCN0000076587 GCCAGAATACTACTACATTCA pLKO.1 317 5UTR 100% 4.950 3.465 N Nox4 n/a
6 TRCN0000046111 CCTCAGTCAAACAGATGGGAT pLKO.1 1684 CDS 100% 2.640 1.584 N LOC729960 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001285835.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03145 pDONR223 100% 75.7% 78.7% None (many diffs) n/a
2 ccsbBroad304_03145 pLX_304 0% 75.7% 78.7% V5 (many diffs) n/a
Download CSV