Transcript: Mouse NM_001285859.1

Mus musculus SH3-domain GRB2-like (endophilin) interacting protein 1 (Sgip1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Sgip1 (73094)
Length:
5004
CDS:
422..2401

Additional Resources:

NCBI RefSeq record:
NM_001285859.1
NBCI Gene record:
Sgip1 (73094)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001285859.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192408 CCAACTTCTCTGCTGTGATAA pLKO.1 1798 CDS 100% 13.200 9.240 N Sgip1 n/a
2 TRCN0000191491 GCTTCAGTTTAGTGGGTTAAA pLKO.1 2921 3UTR 100% 13.200 9.240 N Sgip1 n/a
3 TRCN0000217739 GGTTCTTTACTGGCGAGATTT pLKO.1 2219 CDS 100% 13.200 9.240 N Sgip1 n/a
4 TRCN0000192995 GCCTTTGGAATACGGAAGAAA pLKO.1 455 CDS 100% 5.625 3.938 N Sgip1 n/a
5 TRCN0000191317 CCTTGTTTCTTCTTTACTCAT pLKO.1 3350 3UTR 100% 4.950 2.970 N Sgip1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001285859.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.