Transcript: Mouse NM_001285881.1

Mus musculus RIKEN cDNA D630023F18 gene (D630023F18Rik), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
D630023F18Rik (98303)
Length:
2183
CDS:
122..799

Additional Resources:

NCBI RefSeq record:
NM_001285881.1
NBCI Gene record:
D630023F18Rik (98303)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001285881.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000198637 CTTCCACTCCTCAACTGTTAT pLKO.1 727 CDS 100% 13.200 10.560 N D630023F18Rik n/a
2 TRCN0000200394 GTTGCCAGTCAATGGCTAGAT pLKO.1 269 CDS 100% 4.950 3.960 N D630023F18Rik n/a
3 TRCN0000177726 CTGGAGTCTTAATGAACAGTA pLKO.1 402 CDS 100% 4.950 3.465 N D630023F18Rik n/a
4 TRCN0000198242 GCTTGAGATGTGTTTAGTCTT pLKO.1 889 3UTR 100% 4.950 3.465 N D630023F18Rik n/a
5 TRCN0000198749 CCAATGAGATTTCAGGGCATA pLKO.1 1193 3UTR 100% 4.050 2.835 N D630023F18Rik n/a
6 TRCN0000198578 GCTGGAGTCTTAATGAACAGT pLKO.1 401 CDS 100% 3.000 2.100 N D630023F18Rik n/a
7 TRCN0000177076 GCTTTCAAATGAATCTGGAAA pLKO.1 1262 3UTR 100% 4.950 2.970 N D630023F18Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001285881.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.