Transcript: Mouse NM_001285965.1

Mus musculus selection and upkeep of intraepithelial T cells 2 (Skint2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Skint2 (329919)
Length:
1277
CDS:
32..1204

Additional Resources:

NCBI RefSeq record:
NM_001285965.1
NBCI Gene record:
Skint2 (329919)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001285965.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216008 CAATAGGATTCATGATGATAG pLKO.1 774 CDS 100% 10.800 15.120 N Skint2 n/a
2 TRCN0000200542 CTCAGTCATGTACATTCTAAT pLKO.1 454 CDS 100% 13.200 9.240 N Skint2 n/a
3 TRCN0000189984 GCCACAACAAGCACAGCATAT pLKO.1 181 CDS 100% 10.800 7.560 N Skint2 n/a
4 TRCN0000192929 GCTCAGTCATGTACATTCTAA pLKO.1 453 CDS 100% 5.625 3.938 N Skint2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001285965.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.