Transcript: Mouse NM_001286016.1

Mus musculus casein alpha s1 (Csn1s1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Csn1s1 (12990)
Length:
1409
CDS:
62..946

Additional Resources:

NCBI RefSeq record:
NM_001286016.1
NBCI Gene record:
Csn1s1 (12990)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001286016.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201307 GCCAATGATTCATCTTGAGTT pLKO.1 1107 3UTR 100% 4.950 6.930 N Csn1s1 n/a
2 TRCN0000191537 GCATATTAGATAGCATAGCAT pLKO.1 1135 3UTR 100% 3.000 4.200 N Csn1s1 n/a
3 TRCN0000200552 CGATGAAATCAAGGTAACTAT pLKO.1 262 CDS 100% 5.625 4.500 N Csn1s1 n/a
4 TRCN0000191406 CAGTTTAAGTACAACCAACTT pLKO.1 446 CDS 100% 4.950 3.465 N Csn1s1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286016.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.